EST details — SGN-E59237

Search information 
Request: 59237Match: SGN-E59237
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C46709Clone name: cLEI-13-H13
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177625 is on microarray TOM1: SGN-S1-1-2.1.6.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C46709 [cLEI-13-H13] Trace: SGN-T82469 EST: SGN-E268408 Direction: 5' Facility: TIGR
Clone: SGN-C177625 [TUS-27-A15] Trace: SGN-T182837 EST: SGN-E371329 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E59237Length: 539 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E59237 [] (called/trimmed by facility)
GTAAGACGAGACCCGTATGAAGTGTTGGCTGTGACGAGGGATGTCGTCGGATCAGGAGATTAAGACTGCTTATAGAAAGCTTGCTCTCAAGTATC
ATCCTGACAAGAATGCTAACAATCCTGAAGCTTCAGAACATTTCAAGGAGGTTGCATACTCATATAGCATTCTATCTGATCCAGAGAAAAGGAGG
CAATATGATATGGCTGGCTTCGAGGCTCTTGAAGCTGAAGGAATGGATATGGAAATTGATTTGTCCAACCTCGGAACTGTCAACACAATGTTTGC
AGCATTGTTTAGCAAGTTGGGTGTTCCTATCAAAACAACTATCTCTGCGAATGTTCTTGAAGAAGCTTTGAATGGAACTGTCACGGTCCGCCCTC
TTCCAATTGGTACATCAGTCAGTGGAAAGGTAGAAAAGCAAAATGCTCATTTTTTCGGTGTAACAATTAGTGACGAACAAGCAGAAGCAGGGATT
GTAGTAAGAGCTACTTCAACTGCCCAAAGCAAATTCAAGCTACTATATTTTGAACATGATGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T82469 [Download] [View] Facility Assigned ID: TGSBY43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence