Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E593537

Search information 
Request: 593537Match: SGN-E593537
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C370550Clone name: 36769
nocartOrdering Not Available
Library Name: CSWBOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E593537Length: 657 bp (726 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E593537 [] (trimmed) TGCACATCTTATCGCTACTGATTAAGATTCTTACTTGTTAATATCAGTATACATGTAATGATAAGTTTTAATGTTGTTGATTATGGTACTAAAAC
ATAGCAGTGATTCCACAGAGAGACTAGTGGTCCACTTTAACCTGCTGAATGAAGTTCCTTAGTTTCTTGCTATTTCTAGAAGGAAGTAAATGCTC
TTGAATGCTAACAGTACTAGAGAAGCAAGCCTGTTTGAGAAACTGTGTTTTGAGTAATGCCCACAACATGATGCTGATGTGGGTTGAAACTCTGG
TCTTTTGGTCGCAGCATCTCAGTCTAATCATCTGAGCTAAGCCTTTTCAATTCAGTTTTCTATTATCGTCCTTTCTGCTAGCAGTAGTAGTGAAT
TGAATCAGTGTGTGGATTCGGTTATTAGGCAAGTTCCTTATTAATTTCCTGTTAACTTGTCAATATAGTTTGAATTAATTCTGTGAATTTTTCAG
GGCACTCTCACAGCAATCAGGGATTGGTTTAGAGACTATAAGATACCTGATGGAAAAGCTGCCAATAGGTTTGCTCTTGGCAACAAGCCAGCAAA
CAAGGATTACGCTCTTAAGATTATTACGGAGACCAATGAATCTTGGGCAAAGCTGGTCAAGAGATCAATCGCTGCTGGTGAGCTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E593537] SGN-U287523 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T394413 [Download][View] Facility Assigned ID: bf_cswbxxxx_0012a05.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5