EST details — SGN-E59735

Search information 
Request: 59735Match: SGN-E59735
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C81404Clone name: cLET-16-D8
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182203 is on microarray TOM1: SGN-S1-1-8.4.10.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81404 [cLET-16-D8] Trace: SGN-T106629 EST: SGN-E292496 Direction: 5' Facility: TIGR
Clone: SGN-C182203 [TUS-38-P9] Trace: SGN-T194736 EST: SGN-E393410 Direction: 3' Facility: INRA
Clone: SGN-C182203 [TUS-38-P9] Trace: SGN-T199333 EST: SGN-E398007 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E59735Length: 496 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E59735 [] (called/trimmed by facility)
TATATCGATGACTTGAAAGACCCTGGTCCTAGTGGCAAGCCTTACTCTGCAAGGTACATTGGTAGTTTGGTAGGTGACTTCCATAGAACTCTTCT
ATATGGTGGCATTTATGGTTATCCTAGAGACAGAAAGAGCAAGAATGGAAAGTTGAGGCTTTTGTACGAATGTGCTCCCATGAGCTTCATTGTGG
AACAAGCTGGTGGCAAAGGATCCGATGGTCACCAAAGAGTTCTCGATATCCAACCAACTGAGATACATCAACGAGTTCCATTGTACATTGGAAGC
ACAGAAGAAGTTGAAAAATTGGAGAAGTACTTGTCTTAATTCCAAAATCAAGACGAGACTGTGAATTTGTAATACTCGAAAGAAATTCTTTTCAC
AAGAAGTCTAGGAACCAATTGCTAAAGTCATTATGGTTCAAAGCTTTGCGGTGATTCAATTCATAAAACAATGTAAAGGTTTTTCCATATCTAAA
ATCTGTCATCCTCTTTCTTGN
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T106629 [Download] [View] Facility Assigned ID: TMECL16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence