EST details — SGN-E598038

Search information 
Request: 598038Match: SGN-E598038
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C375051Clone name: 73705
nocartOrdering Not Available
Library Name: CSWBOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E598038Length: 680 bp (792 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E598038 [] (trimmed) GTTAAACATTATGAATTTTTTTTGGGGCAAAAGAATTGCAGAGTGAAAAAAAAGAAGCTAATTGAACATTGAGCATGAAGAAGCATCTCTTCCTC
TTCACAATACTCATCTTCTCCAAGGCACTGGTGAATGAAGTTAGGGGCTTCCTTGAAATATCCAGTAGTTGTAAGCACTTGGCCTTTTTTTGGAA
GCTGTTAGAGCTGCCTGGAACGCCGTTGACGGGTGGTTTTTCTGCGGTGGATGCAGTTGTGGAAGGTTGTTCTGCTTGTGAAAAACTAAGATGTG
ATGGTACAGTTGGGCCTGGTGGAAGTCCAGACGAGAATGGAGAAACTACACTTGATGCCATGGTGATGGATGGGGTAACAATGGAGGTCGGCGCA
GTTGCTGCTATGAGATATGTGCCAGAGGGAATTAAAGCTGCGAAGTTAGTGTTGGAGTATACTAAACATACTATGCTTGTCGGGGATCAAGCTTC
AGCTTTTGCCATTTCGATGGGCCTTCCGGGGCCTACAAACCTAAGCTCAGTTGAGTCAATAGAGAAGTGGACAAAATGGAAAGATAGTTCTTGCC
AACCTAATTTCCGGAAAAATGTTATCCCTAGAGATAGTTGTGGTCCATTCCATCCCAATGGGCCTTCAATAAGAAGATGCCTGATGGATAACGAG
CTCAGGCCTAATGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E598038] SGN-U297700 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T398914 [Download][View] Facility Assigned ID: bf_cswbxxxx_0061a07.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5