EST details — SGN-E599049

Search information 
Request: 599049Match: SGN-E599049
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C377143Clone name: 52028
nocartOrdering Not Available
Library Name: ACDCOrganism: Solanum tuberosum

Tissue: Sprouting Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E599049Length: 714 bp (814 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E599049 [] (trimmed) TTTGGTTAAACATTGTCTCACTAATACAAAAAACAACACTTCAAATTCAAAAGTACAATCTGCAGAAGTATGAAATGAACACGACAAATAGCTAG
AACGAAAAGGAATAGTAATAATATACATTATTATATCTTGTAACGCAACAATGCAGAAGTTCCATCTATGCCTTTATTATAGATGTAACTCCTGT
AGTCTTTCAATGTGGTTGCGCGATATTTTGGAGGATTATCTTCTGATAATAATTCAGTAATTGGTCCATAAAGCTTGGAAGATTGCACATTATCA
CCAAAGAAGCAGGCAACTGACATTCTTGACACATCTTTATTTGCAATTACTCTGTGTTCAACACTTAGGTACTTGTCATTTGACATGAGCTGAAG
AAAATCTCCAATGTTAACGATGAGAGCACCAGGTATAGGAGGAACATTAACCCATTGATTCTGATGAAGAACTTGGAGTCCTCCGATTTCATCTT
GTAGAAGAACTGTGAAAAAATCACCATCGGAATGTTGTATGGTGCCCATGGTGAGTTCGGGCTGAGGGCATGATGGATAGTAATTGCTCAAAACA
CTAAGCCCTTTAGCACAATCCATATCATTGCGATGACAACGATCAAGATCGAGACCTTCAGGACAATAATTCAAGCAAGGAGCAGCCAATTTCGT
CACATCCTTGGAGAAATCCCATTAGTATTTCCCCGGATACTGTTTGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E599049] SGN-U292031 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T401006 [Download][View] Facility Assigned ID: bf_acdcxxxx_0005e04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5