EST details — SGN-E60274

Search information 
Request: 60274Match: SGN-E60274
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1492Clone name: cLEC-12-L20
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1492 [cLEC-12-L20] Trace: SGN-T25886 EST: SGN-E200301 Direction: 5' Facility: TIGR
Clone: SGN-C167702 [TUS-1-D4] Trace: SGN-T196 EST: SGN-E379337 Direction: 3' Facility: Avesthagen
Clone: SGN-C167702 [TUS-1-D4] Trace: SGN-T1138 EST: SGN-E379602 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E60274Length: 492 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E60274 [] (called/trimmed by facility)
CTTTCTTCTTTTCTCTCTCTAAAATTCTCATCCAAAAACGACCACACAATACAGTAGAGAGAGAAAATCAAATCGAAGATTTTACAGAAGGATAT
CGAGTTTCTTCGGAGACGAAGGGTAGCTTAATCCTCCATTCGATCTCAAAAGGGGAGGTGTGATTTTTTTATTTTTTATTTTAAAATAATTTTTG
GATATGAGAAGAGGCAGAGCAACTCCGGCGGCGGCGGCGGCGGCGGTGAAGCCAGATGGATCTGGAGGATTGAAGGAGATTAGGTTTCGTGGAGT
TCGGAAGAGGCCATGGGGGAGATTTGCTGCAGAGATTAGAGATCCATGGAAGAAAACTAGGGTTTGGTTAGGTACTTTTGATTCAGCTGAAGATG
CTGCCAAAGCTTATGATGCTGCAGCTCGAACTCTTCGTGGACCTAAAGCTAAAACTAATTTCCCTTTACCTATGTATTCTCAGCATCATCAGTTC
AATCGAAGTTTAAACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T25886 [Download] [View] Facility Assigned ID: TCABV70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence