EST details — SGN-E607820

Search information 
Request: 607820Match: SGN-E607820
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C384653Clone name: 23793
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E607820Length: 515 bp (665 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E607820 [] (trimmed) TGATATGGAAGATCGGTATTCTGCGGTAGTTAATGATGATGCTAAAAACGGCTCTAAACAGGCCTTTTTTGGTGTATTTGATGGACATGGTGGAG
CAAAAGCTGCAGAGTTTGCGGCAAAGAATTTGGGCAGGAATATTATAAATGAAGTGGCGTTGAGGAGTGAAGAGGGACTAGAAGAGGCAGTCAGA
GAGGGTTACCTCACTACAGACGCGGAGTTTCTTAAGCTAAATACAAATGGAGGGAGCTGTTGTGTGACTGCACTGGTACAGAATGGAGAACTTAT
TGTATCAAATGCTGGTGACTGTCGTGCTGTTATGAGCAGAGGAGGAGTGGCAGAGGCACTCACAGTTGATCATTGTCCTTCGAGGCAAGATGAAA
TGGAAAGAATTCAACGCCTAGGTGGCTATGTAGATTGTTGCCGCGGTGTGTGGAGAATTCAAGGATCTCTTGCTGTGTCACGAGGAATAGGAGAT
TCCCAGCTTAAGAGATGGGTGATAGCTGAACCAGAGACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E607820] SGN-U298881 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T408516 [Download][View] Facility Assigned ID: bf_tubsxxxx_0032c06.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0003 Quality Trim Threshold: 20.5