EST details — SGN-E60806

Search information 
Request: 60806Match: SGN-E60806
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C8832Clone name: cLEC-53-G3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C8832 [cLEC-53-G3] Trace: SGN-T33013 EST: SGN-E209231 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E60806Length: 560 bp (called/trimmed by facility)
Status: Legacy Direction: 5'
>SGN-E60806 [] (called/trimmed by facility)
AGATAGTGCAAGAAAGTCTTGCTGATGTCATTAACATTAAGCTTGCCAAAGTTGGGGTGCTTGGGGCTCTGGAAATTATTGACTTGGTGAGGTCC
TCGGGCTTAAATCTGATGATCGGTGGTATGGTTGAAACCAGGCTTGCCATGGGCTTTGCTGGTCATCTAGCCGCTGGCCTTGGATGTTTCAAATT
CATTGACCTAGACACACCCCTTCTGTTGGCAGAAGATCCAGTTTTTGGGGGTTATGAAGCTTCTGGACCTGATTACAGCTTCTCAAATGCTAGAG
GGCACGGTGGTTTTCTTCATTGGGAGAATATTGCATGATATTAGTAGCGGAGCTTGTTCACTCTTCAGGATTGTCACTCACAACCTAATTATAGT
TATGCATATGTACTTGTGAATTAGTCGTTGGTAAATTTGAAATGTTTATGTGCCAAAGAATTGGAACACAATGCTAGAATATCCAATCTTTAGAG
TAAACAAATATGTAAATGTCTTATTGTCTGTTGAAATTGATGTTAGTTGAGAACGTCTTGCTTGATCTTCTCTTTGACAATCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T33013 [Download] [View] Facility Assigned ID: TCAIA38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence