EST details — SGN-E611299

Search information 
Request: 611299Match: SGN-E611299
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C388312Clone name: 61049
nocartOrdering Not Available
Library Name: MXLFOrganism: Solanum tuberosum

Tissue: Leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E611299Length: 385 bp (624 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E611299 [] (trimmed) AAACTAGTGGATCCCCCGGCCCTGCAGGTAAAAATGTGAGATTTGGCCATATGTGCCATATAGTATGGTGGCACATCCTTATGCTGCTGCTGTTT
ATGACAAAAAAGCACCTCCTAATTTTGTAAGGGCAACTGCTGATCCTTCTGTTGCTCACTTAAATCCTGTTGAAGAACAATATTCCCTTATGTTT
AGTGATGAAAATCCAAATGCTTGTAATATTATGTAGTAGTTAATTATAATTTTTTTTCTTTGTTATAAAGTATATATACTTCTTTATGTGTATTT
TTATGTATACTTAAAACCTGTTGAAGAACAGGTAGGCTATGATAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAA
AAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E611299] SGN-U291110 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T418053 [Download][View] Facility Assigned ID: bf_mxlfxxxx_0005g01.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.902 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5