EST details — SGN-E619894

Search information 
Request: 619894Match: SGN-E619894
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C396907Clone name: 70589
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E619894Length: 612 bp (917 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E619894 [] (trimmed) GGAAGTGTTCTTAAGATTTATCCCTTCATCATGAATATGAGCCTTATTTTACAGCAAATCAAATCACATTATTTACAGCAAATAAAATGCTGATA
TCTTTTCTAAAAGTTTATGTGTGATTTTTGCTGCTGCTTGGCGATATGGCGCCAGGTCATTCTTCAGAGTCGGAAATGATCCAGACCGGAAATAT
CAAGAGGCTTGGAGAAAAACTTAGTGATGTAATCACTAGCAATAAATTCTTTATATAGTGGAGGATTTTCTTCTGATATGAGCTCTTTGATTGGA
CCATATATCTTTGAAGGTTCGAAAACCCCAGTGAAGAAGCATGCTGCTGATATCCTTGGTCCTACCTTTTTCGCTACAGCTCTATGATTTATGCT
TACAAATTTGTCATTTGAAAGGATCTGAAGAAAGTCACCAATGTTAACAACCAAACCTTGTTCAATCGGTTCAACATCGACCCATTGGTTATTAT
GCATGATTTGAAATCCACCACTTTGATCTTGAAGCAAGATTGTGAAGAAAGAAATATCTGTATGCTTATCGATACCAAGAGTTAGCTCTGGCTGT
GGGCAGGCTGGGTAGTAGTGGCATATCAATGCTTGTCCTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E619894] SGN-U290268 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T420770 [Download][View] Facility Assigned ID: bf_mxflxxxx_0028g05.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5