EST details — SGN-E620751

Search information 
Request: 620751Match: SGN-E620751
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C397764Clone name: 71456
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E620751Length: 596 bp (811 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E620751 [] (trimmed) TTTTATCTAAAGTATAATATATTCAAAGAACAATACACATAGATGAAAAGATCCAATCCATAAGTAGATAATATCTTCAAGTAGAAAAATCAACT
TGATGTTTATTTTAAGTATTACTTACTACTTTATTTCACAATTGCCATAATATTCATGTGCACACAAATTTAAATTGTTATTTTGTCACACCTAC
CGAGGATGTAATAATGTGATTGTGACTTCATTTTTTGAACTTCTTGTCTGCGATCCTGATTTTCCTTCGTCATATACATTTCGTTCTGTGAAAAA
TCCTGGTTCTTTTGCTTTTGGCAGTAGACTCTCATTAGCCAACATCTGAACCACAGTAAACATGCTTGGTCTATCATTCGGATGTTGTTGCACGC
ATAATAATCCCACTTGAATTGACCTTAAAACTTGAGAAATGTTGCAAGAGTAAGCTAGCAGCTCATCAGCTAGTTCCAACGACCTATCCTCTTTG
TAAAGAAGTTTACACCTTTTTTTTCCCTCTCAACAAAGAAAAAAACATCACATAATTAAAAAGAGAGAGAAAATGGATGGAAAGAGGAAAATATC
TGTAGCAATTGTAATAATACAAGCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E620751] SGN-U290150 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T421627 [Download][View] Facility Assigned ID: bf_mxflxxxx_0038d12.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0036 Quality Trim Threshold: 20.5