Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E640419

Search information 
Request: 640419Match: SGN-E640419
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C453627Clone name: cccs42w2d12
nocartOrdering Not Available
Library Name: cccs42wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 42 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E640419Length: 458 bp (563 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E640419 [] (trimmed) GTGCATAGGCTTACATGATTTTGAATTCGATGGATTGATGGAATTTTTTTCATCCAAGAATTGTAAGCACGATAGTCATATTCAATCTGGAAGAT
GAAAAAGGCAGTGAAGATCGAGGCTTCTCTTGAGGAGGATGATGGAATTGATGAGGAAGTTGCTGAGATACTGTCGTCCCAAAAGCTGGAAGCGG
TGGACCGAGTGGATCTTTCGGGGCGTCAACTTAAATTTCTACCTGAAGCTTTCGGCAAACTTCGCGGCTTGATCGTTCTCCGTCTCTCTCATAAT
CAACTGGAGATCATTCCCGATTCAATTGCTGGTTTGGTGAGGTTGGAGGAGCTCTATTTATCTGCCAACCACCTGCTAACGTTGCCTGATTCAAT
TGGTTTGTTGACAAATCTGAAAGTTCTGGATGTGTCCGCAAACAAGCTTAATTCCCTGCCTGAAAGCATTGCTGGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E640419] SGN-U624434 Coffea canephora Build 3 1 ESTs assembled
[SGN-E640419] SGN-U633720 Coffee species Build 1 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T477490 [Download] [View] Facility Assigned ID: cccs42w2d12.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15