Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E641729

Search information 
Request: 641729Match: SGN-E641729
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C423839Clone name: cccp25l23
nocartOrdering Not Available
Library Name: cccpOrganism: Coffea canephora

Tissue: Pericarp
Development Stage: All development stages combined

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E641729Length: 381 bp (1005 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E641729 [] (trimmed) GCTTCAGGATGCCCTTTGCAAGACATTTTCTGTAAAAAAGAAAAAGGGAAAACTTCGGAAGGCTTGGGATGGGAGCAAAGTTATCTACAATGTGG
CATCCTGGGGAGCTACAGCCATTGGCATATACCAAAACCCAGCGATTCTGAAGGCTGCCTCAGCAGCATTCTGGACTTCCTGCCGTGTAATATCA
AAGCTCTTCTGAGCAGTGTGGCACACTTTGCGGGAATCAATCGTGTGCTTGTGCTGCCAAAAGTGCTTCCCTATTCTTTAGAAATGTGTAACATA
AATGCCATTCATTGTGTGTGTGTGTGTGTTGCAATTGATAGCTCCAATGTTGTTTAACCCTGTAAATATTCTTTCAATGAATACTTGTCGTCTTC
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E641729] SGN-U623838 Coffea canephora Build 3 1 ESTs assembled
[SGN-E641729] SGN-U630338 Coffee species Build 1 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T447702 [Download] [View] Facility Assigned ID: cccp25l23.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15