EST details — SGN-E64342

Search information 
Request: 64342Match: SGN-E64342
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1920Clone name: cLEC-14-E4
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173248 is on microarray TOM1: SGN-S1-1-3.3.20.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1920 [cLEC-14-E4] Trace: SGN-T26249 EST: SGN-E204633 Direction: 5' Facility: TIGR
Clone: SGN-C173248 [TUS-15-K6] Trace: SGN-T188746 EST: SGN-E375892 Direction: 3' Facility: INRA
Clone: SGN-C173248 [TUS-15-K6] Trace: SGN-T188747 EST: SGN-E375893 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E64342Length: 369 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E64342 [] (called/trimmed by facility)
GCTTTCTTCAGGGATTTAAAATAGGAAAAAATTATAGTTACTGCTTACAGCCTTAAACATGACAGTTACAACGGACAACTGGAAGGTAACTGTAA
CAGAAAGGAGATTAGAATTTGCAAGTTTAAAGGGCAACGGAGTTGAGTTTTTTTTTTTTTATCAACAAAATCAATTACAAGACTATGCTGATGAA
AGATATCAGCTTAATCTTCTGAAGCAAAATTTATGTACAAGTCTTGTATGATCGATCACAAAGTTGGCTGTATCTTTCTGGACCGCATGTATTCC
AACAACTGAGAAAGTAATTCTGCTTAAAGTGATTGAACGACTGAGACATCTCCATTTTGTACATCACGGAGGGGAACAAATTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T26249 [Download] [View] Facility Assigned ID: TCACB26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence