EST details — SGN-C648

Search information 
Request: 648Match: SGN-C648
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C648Clone name: cLEB-7-L1
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEB-7-L1.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200123Length: 584 bp (851 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E200123 [] (trimmed) CGGCGACGAACAACAATCTCACTGAGAGAATCACTCCGGCGACCGACTACAAACAACGATGAGGCCAATATTGATGAAGGGCCATGAAAGGCCGT
TAACTTTTCTAAAGTACAACAGAGATGGAGATCTGCTCTTCTCTTGCGCTAAGGACCATACCCCTACCGTTTGGTTTGCCGATAACGGCGAGCGC
CTCGGCACTTACCGTGGCCATAACGGTGCCGTTTGGTGCTGTGACGTTTCTCGGGATTCGTCCAGGCTAATAACTGGAAGTGCGGATCAGACTGC
AATGTTGTGGGATGTCCAAACTGGTGCCCAGCTGCACACGTTCACCTTTGACTCCCCTGCTAGGTCTGTTGATTTTTCAGTTGGCGATAAACTCG
CAGTGATCACCACTGATCCTTTTATGGGACTGACATCTGCTATCCATATCAAAAATATCAGCAAAGATCCCAGTGAACAAATGAGTGAGTCGGTG
CTCGTCTTAAAGGGTCCCCAGGGAAGAATCAACAGAGCTGTGTGGGGACCCCTGAATAAAACAATTATAAGTGCTGGTGAAGATGCTGTAATACG
TATCTGGGATGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200123] SGN-U575556 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22695 [Download] [View] Facility Assigned ID: TSHBA61THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5