EST details — SGN-E65452

Search information 
Request: 65452Match: SGN-E65452
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2141Clone name: cLEC-14-P15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173364 is on microarray TOM1: SGN-S1-1-7.4.20.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2141 [cLEC-14-P15] Trace: SGN-T26485 EST: SGN-E204869 Direction: 5' Facility: TIGR
Clone: SGN-C173364 [TUS-15-P2] Trace: SGN-T189034 EST: SGN-E375420 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E65452Length: 483 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E65452 [] (called/trimmed by facility)
GTAAAATAAACATGCCCATCATATCTACTACTTCCCCTCGTTCGTTTCTTCAAACTCCGCCACCGCCGGTGAATATATTTTCCTCCGGCGATAAT
TCTCTTCTATCACCGTCTTCCGTCAGATTCCGTCAGTCCGGTAACTTCACCACCGCCGCAGCGGCGGCGGCGACTTGCGCTTCCGTCGAAACTGA
ATCTACCACGTCAAGGTACTCGACGCTGCCTTCTGACATTATCCATGCTTCTTCGGCGTCTTTCTACGAGATTCTAGGGATTCCGATCGGCGCTA
CGATCCAGGAGATCAAGGCAGCTTATCGGAGATTAGCTAGGGTTTGTCATCCTGATGTGGCGGCAATTGATCAGAAGGACACGTCGGCGGACGAT
TTCATGAAGATTCATTCTGCCTATTCTACTCTTTCGGATCCGGATAAACGCGCCGATTATGACCGCCGCCTATTTCGGAGGCGCCGGAACGTCAA
TTTATACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T26485 [Download] [View] Facility Assigned ID: TCACC92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence