Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-E65599

Search information 
Request: 65599Match: SGN-E65599
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C56825Clone name: cLEL-30-D19
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C56825 [cLEL-30-D19] Trace: SGN-T13731 EST: SGN-E227166 Direction: 3' Facility: Cereon
Clone: SGN-C56825 [cLEL-30-D19] Trace: SGN-T14237 EST: SGN-E227672 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E65599Length: 675 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 3'
>SGN-E65599 [] (called/trimmed by facility)
GATAATGTTAAGATCCTTTTTTTTTTTTTTTTTTTTTTTCAACAATCTAATTAACATCTTTTATTCTATTTTACAAAAGAAAATTACCTATACAT
AGTTTATCATTTAATAACAATTTTTAATGAAAAAAAAGACAACCCCATTAATAGAAGCCCACATTGAAGAGCCCAGACATTGACCCATCACCTTA
CATAATTGAGCAAGCATTAGCATTTTCATCATTAAAGTACTGATCACATCTGCTCACATAACAGCCCCTACCATAGCCATAAGGCCCAGGCCCAT
AGCTATCGTAACACGGCGGCGGAGGGACCGGTCTTCCCCACCCTTGATAACACGGGCCCCCGGTTTGGCCTTCGTAGCATTGTCCACAACAGTAT
TCCGGTGGCGGAGGGGCCGATCGTCCCTGGTGCCTTTGCTATATTGACTTTCAACGACACGCTACGGCCATTGGGAAAGGGGCGGGTGTACAAAT
TTTGAAAGCCCGTGTTTGGGCCAACAAACTCCTTGGGTAAGGGGGGGCTGGAACCCCGGGAAACGTTATCCCCCTTGTGTGGCAACCGTTCACTG
TATGGGCATTATCTGTTTCGCAGGGAGGCTAGGTTTTGGGATAGCGGGCCTTCCCTTTTAATGGGGTTGGTTATATGTTTCGGGTTTCAAGGCGG
GCCCTCTCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T13731 [Download] [View] Facility Assigned ID: cC-esflcLEL30D19d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence