EST details — SGN-E660005
Search information |
Request: 660005 | Match: SGN-E660005 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C408787 | Clone name: cccl17n11 |
| ||
Library Name: cccl | Organism: Coffea canephora |
Tissue: LeafB
Development Stage: Young
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E660005 | Length: 287 bp (1357 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E660005 [] (trimmed)
CCCTTTAAAAACTATCCCTCACCACCACCACCAGTGCATATACCTCCACCTCATCCTGTTTACAAGTACAAATCTCCACCACCCCCACCACCACA
CCAAGTTTACAAGTATAAGTCACCACCACCACCTCCTCATGCGGTATACAAGTATAAGTCTCCTCCAACCACCACCACACCCAGTTTACAAGTAA
AAGGCACAACCACCACCTCTTCATCCGGCACCACATCCAATTAACTAGTATGAGTCTCCTCCACCACCTCCTCATACTGAACAACACCCAGTTTA
CA
CCAAGTTTACAAGTATAAGTCACCACCACCACCTCCTCATGCGGTATACAAGTATAAGTCTCCTCCAACCACCACCACACCCAGTTTACAAGTAA
AAGGCACAACCACCACCTCTTCATCCGGCACCACATCCAATTAACTAGTATGAGTCTCCTCCACCACCTCCTCATACTGAACAACACCCAGTTTA
CA
Unigenes |
Current Unigene builds | |||||
[SGN-E660005] | SGN-U617361 | Coffea canephora | Build 3 | 29 ESTs assembled | |
[SGN-E660005] | SGN-U637534 | Coffee species | Build 1 | 5 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T432650 [Download] [View] | Facility Assigned ID: cccl17n11.i |
Submitter: None | Sequencing Facility: Cornell |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |