EST details — SGN-E669726

Search information 
Request: 669726Match: SGN-E669726
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C458393Clone name: cccs46w16e13
nocartOrdering Not Available
Library Name: cccs46wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 46 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E669726Length: 367 bp (1019 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E669726 [] (trimmed) GACCGGTCCCATAGGCCCAACTGGTATCATACTCCACCGCCCATCGCTCATGTCAATCAAGGAAATGACATCATCTTCGGCTTTGGATGTTGTTG
ACACATTTTCTGACAGGCCACTGTTCTTTGGAGGGCCCTTAGTAGAAGGGATTTTCCTGGTGAGTCCTGAAGATGGAAAAGATGGGGTTGGAAGG
AGCGGAGTGTTGGAGGAGGTAATGAAGGTACTGACCTCCAGATCTTCCGAACTGGAGAATTCTTCTCTGTAAAAGGAACCCAGTACTATTTCTTG
AATCCCCAACTTATTATTCTTCGAATGAAATGCCTTCCGAGAGACAGAGCTCCTTCTGGATATAATGAGAATTATGCCCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E669726] SGN-U617120 Coffea canephora Build 3 144 ESTs assembled
[SGN-E669726] SGN-U637477 Coffee species Build 1 153 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T482256 [Download] [View] Facility Assigned ID: cccs46w16e13.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15