Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E689639

Search information 
Request: 689639Match: SGN-E689639
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C466645Clone name: LH_Ea01G21
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C466645 [LH_Ea01G21] Trace: SGN-T494006 EST: SGN-E693479 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E689639Length: 797 bp (1002 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E689639 [] (trimmed) TCGAGATCCTAATGGTCCATTGAGAATGCCTATTATTGACAAATTTAAAGACATGGGAACTGTCGTTATGGGTAAAATTGAGTCTGGAAGCATAC
GTGAGGGTGATAATCTACTGATTATGCCAAACAAGGCTGCTGTAAAAGTTCTTGCGATATTCTGTGATGAAGATCGAGTAAGGCATGTTGGTCCC
GGAGAAAATGTGCGTGTTAGGTTATCTGGAGTTGAGGAAGATGACCTTTTGTCAGGCTTTGTCTTGTGCAGTGTTGCAAAGCCAATACCTGCAGT
TACTGAGTTTGTTGCGCAGTTACAGATTCTTGAGCTGTTGGACAATGCTATTTTTACTGCTGGATACAAAGCTGTATTGCATGTCCATGCGGTTG
TTGAGGAGTGTGAGATTGTTGAACTGATGCAGCAGATTGATTTAAAAACGAAGAAACCTATGAAGAAAAAACCTCTGTTTGTTAAGAATGGCGCT
ATTGTTTTATGCCGTGTTCAGGTTAGCTATCTAATTGAATGCCTGTAGATTGGGAATACATGGTTCTTAGATCAATTCTTATGGTTCTGTCATTC
ATAATTTTGGGTGACTTCGAGTTATATTTGAATTTGCAGAAGGTACAATTCCTGTATCACAATGTGTTTGTGTTTTGTCCCACCTTTCTAACAGG
GAATGATGAAGATTTTCTAGTTTGAGGACAAAATCATTGCTTTACCTTGAAATCCCTAGTCCCTTTCAAGTTCACCCTTTTTTGGTTGTTTTTAG
AGCTAGATCCTTAGGTTAACGTCTTGTGTTGGTATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E689639] SGN-U596901 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T497859 [Download] [View] Facility Assigned ID: LH_Ea01G21.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5