Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E690393

Search information 
Request: 690393Match: SGN-E690393
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C467399Clone name: LH_Ea03G07
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C467399 [LH_Ea03G07] Trace: SGN-T493255 EST: SGN-E694233 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E690393Length: 794 bp (1056 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E690393 [] (trimmed) CCGGTAACAACTCAAAATAAAATCATATATTCAACTTGTCATGGCAACTTAAGTCTTTAAAATATTTAACAAAATAAATGAACAGACTTCTGAAA
CTCTATTGTCTATTTATGAAGCCTCTAAATGACAAAGATGGAAGTCACCACAAGACCCACGACCTCCTAAAAACTTATATGACTGAAAGTAAAAG
TGGAACCCTCCGGAAGTAAGGAGGCTCATCATAGCTAACTCAAGCTCCATGTGGTGATACGAAGTTCCTGACCCTGAATAATACATGTATCTGCA
TCATGAAAGGATGAAGGCCAAATGGCTCAATACGTCAAATGCACAAGCATGTAAGGGGAATCCTAAAGTACAACATAAGCTTGAACTTAATAAAC
AAGAAACATACTTACCTCTTCTCAAACTTACTCAACTCAACTCAACTCAAGAATAAGATACCCAACTCAACGATTATATACTCAACTCAATGGCC
TCGTGCCGAATTCGGCACGAGGCAAATTTGTTGTTGCAAAAAAAGCTGACAGTCTTTACCCCGTCGTAAGTGGAGCCAGTATTGTTGCAAAGGTT
ACTAGGGACCGAGCCTTGCGGGATTGGGTGCTTGATGAAACTGCTGAGAACATGCAAAGGAACTTTGGATCTGGATATCCTGGAGATCCTGAGAC
AAAAGCTTGGCTAGATAATCACAAACATTCAGTTTTTGGGTTCCCAACCTTGGTCCGTTTCAGCTGGGGAACATGTAACGCATACTCCAAGGATA
ATGTCAAAGTAGTATGGGGAATCTGATGCCAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E690393] SGN-U587318 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T496945 [Download] [View] Facility Assigned ID: LH_Ea03G07.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5