EST details — SGN-E692048

Search information 
Request: 692048Match: SGN-E692048
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469054Clone name: LH_Ea07L06
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C469054 [LH_Ea07L06] Trace: SGN-T491987 EST: SGN-E695888 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E692048Length: 506 bp (1165 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E692048 [] (trimmed) ACGATTAAGGGTANGATATCCATTTTGGTTTCACTGCGTTCTATTCTTTTTGGAAGGCATCAAAAATCTATATTACAATCACCTAAGCCAAAACT
ATTTGTCATGGGTACTAATGATGGTTTCACTAGCGTTAAACAATTGGAGAACAATTTGAAGGATGCTGCTGGACATAACACAACTCATCTTATTC
AAGGAGCTACCCATTTTCAAATGGAAGGTCATGCTTTTGATGCAAACATGGTCAACCTGATTCTTCAATTCATTACCACATTATGATCTATGAGT
GATTTCATGTATTAGTTAGTTATAATAATACATTGCGTTAGTTTTATACATGCATAATGTATTTCATATCTATCAATTATGATGTTCGTATCTAT
CAATTAAACATCATATAAGTTATAGCCACATAATATCCAACTACCTACCAAAGCTATTTCTGAAACACATCCCTTTCTTATTGCTTTGTGCACTA
CCCGGGGGAACCACTAATTCTAAAACGGCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E692048] SGN-U567297 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T495380 [Download] [View] Facility Assigned ID: LH_Ea07L06.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0249 Quality Trim Threshold: 12.5