EST details — SGN-E692135

Search information 
Request: 692135Match: SGN-E692135
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469141Clone name: LH_Ea07O21
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C469141 [LH_Ea07O21] Trace: SGN-T491498 EST: SGN-E695975 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E692135Length: 818 bp (1034 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E692135 [] (trimmed) TAAGAATCAAGTGCAAAGATGGAAGTTGCTACAGATGAGCAACACACTCCTATTAAACAAGACACAAAGAAGGGGAAACTTCGATACTATCCATA
TAATATTCACTGGAACTATGGATTGCTTCCGCAAACATGGGAAGATCCTACTTTTGCGAATACCGAAGTTGAAGGGGCATTTGGTGATAATGACC
CTGTTGATGTTGTTGAGATTGGGGAAAGCCGAGGTAAAATTGGCCAGGTTCTGAAGGTCAAACCTTTAGCTGCTCTGGCAATGATTGATGAAGGA
GAACTTGACTGGAAAATAGTTGCTATTTCACTAGACGATCCAAGAGCTTCACTTGTTAATGATGTTGATGATGTGGAAAAACATTTTCCGGGCAC
TCTCACAGCAATCAGGGACTGGTTTAGAGACTATAAGATACCTGATGGAAAACCTGCTAATAGGTTTGCTCTTGGCAACAAGCCAGCAAACAAGG
ATTACGCTCTTAAGATTATTACGGAAACCAATGAATCTTGGGCAAAGCTGGTCAAGAGATCAATCGCTGCTGGTGAGCTTTCACTTGTATAAATG
CTGATTAATAGAGAGCTTAAGCTGGCTAGTTCTCCTGCCTGTAACCTAAACTGGACATGGAAATTGTCCCCATGATTGTACTCTTTCGTCTGGGG
TGGAAGCCAATTCATATTTTTAAGATGACTTCTTGTTATAAGCTACTGTTTTTCCTTTATCATCAATAATTTTGTTCATCCAGTAGCGTCTGTAA
GTTATCCAGAACGAAACAGGTGTATTGAACTATTGATATATGATTTGATCTTCATTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E692135] SGN-U594427 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T495355 [Download] [View] Facility Assigned ID: LH_Ea07O21.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0012 Quality Trim Threshold: 12.5