EST details — SGN-E693359
Search information |
Request: 693359 | Match: SGN-E693359 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C466525 | Clone name: LH_Ea01B21 |
| ||
Library Name: LH_Ea | Organism: Solanum habrochaites (formerly Lycopersicon hirsutum) |
Tissue: Glandular Trichomes
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C466525 [LH_Ea01B21] | Trace: SGN-T497979 | EST: SGN-E689519 | Direction: 5' | Facility: AGI |
Sequence |
Sequence Id: SGN-E693359 | Length: 172 bp (1058 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E693359 [] (trimmed)
TTTTTTTTTTTTTTTTTTTTTTTTTAACTTATTGTAAAACCACTTTAAAAGTTCTTATAAGTTCACTTGCATTATTATTTCCTCTCAAACAGGAA
CAAAGATAAGGAGAAAGGACCCATAGGCCATCATGGAAAAAAAACTAAATAAATACATCAAGTGAACTGCAAATTAT
CAAAGATAAGGAGAAAGGACCCATAGGCCATCATGGAAAAAAAACTAAATAAATACATCAAGTGAACTGCAAATTAT
Unigenes |
Current Unigene builds | |||||
[SGN-E693359] | SGN-U579419 | Tomato 200607 | Build 2 | 2 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T494516 [Download] [View] | Facility Assigned ID: LH_Ea01B21.r |
Submitter: Eyal Fridman | Sequencing Facility: AGI |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.869 | Expected Error Rate: 0.0136 | Quality Trim Threshold: 14.5 |