EST details — SGN-E693413

Search information 
Request: 693413Match: SGN-E693413
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C466579Clone name: LH_Ea01E03
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C466579 [LH_Ea01E03] Trace: SGN-T497925 EST: SGN-E689573 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E693413Length: 432 bp (1141 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E693413 [] (trimmed) TTTTTTTTTTTTTTCTTTTTGGGACACACAAAACACGAACCTTTTAAGAAAACTTGTTCCGAGGAAATTGAGGTTACACTGCCTTAAAAATACAT
GATTGGTTACGTTACATTCATACTGGGTGTAGATGATACATCCAAGTAAAACAGACATGCATTGGGCATTTCTTGAAGAATTTCACTTGCTAGTC
CTAATAATGCCCAAACTACTATCTATGTTCAAGGGTGCACATCCAAATTCCTTGTCTTTCATCTAAACTTCTTTGTCTCAGAATCTAATATCAAA
AATAAAGAACCTACACTCAGATGAGGGAGGCACAAACCACGTATTGAAAATCATGGTTTCCAAGGAGCTGGCGGAGGTGGTGGAGTGGGAAACAT
CGGTGGTACTGCAAAAAATAAAGTGTTCTTATCAATTCCGACATCTCTATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E693413] SGN-U571688 Tomato 200607 Build 2 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T494072 [Download] [View] Facility Assigned ID: LH_Ea01E03.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0138 Quality Trim Threshold: 14.5