EST details — SGN-E693756

Search information 
Request: 693756Match: SGN-E693756
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C466922Clone name: LH_Ea02C10
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C466922 [LH_Ea02C10] Trace: SGN-T497553 EST: SGN-E689916 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E693756Length: 671 bp (1171 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E693756 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTTTTTTTTTTTTTTTTTTTTTTAAACAACTTTCCGCAACCTTTTATTATAACAATC
AAAAAAACCCCAACTTTCAGAAAGGGCAAAAAACCTAATAAACCAAAAAGGGTCGGGTATAACCTTTCTTCCGCAAAGAAAAAAAAAAGAGGGGT
TTAAATTTAATCAATAGTCTGCATGACCCCCCCAGAAGGGAATTTTGTCCCCTTTTCCTTATCAACAGCAGCCCGACCCTTAGCCTTACGATCCA
AAAAAAAATTACGATCCTTTTCGGGGCGGGGCTTGGGAACAACCACCTTAGAGGGGTTAAAACCCACTTTAACAGGAAATCCGGTAACCTTTCCC
CTAGTTATACCTTCAAGGGGAAAAACCCTTTTTTTACGGGACCCTTGGATAATTTTTCCTTCCGGGGCCTGGGGGGGTCCCCTTACAAATTGAAC
TTCCTCGCCTTTTCTTACGGGGAAAAATCTGACGTTGTACTTGGCACGTAACCCAAAAGAAAGGGGGGGGCTCTTCAACCCCCGGGGAACCCTAA
AGGGGGCAAGGAAATGGGCCTTTTTGCCCTTGGGGGGAAAAGAGGAAACCCTTGGGGGGGACTTCTTTGGGGCAAAATTGGATTTCCAAACTAAA
CCTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E693756] SGN-U601427 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T493633 [Download] [View] Facility Assigned ID: LH_Ea02C10.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.923 Expected Error Rate: 0.0298 Quality Trim Threshold: 14.5