EST details — SGN-E694065

Search information 
Request: 694065Match: SGN-E694065
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C467231Clone name: LH_Ea02P07
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E694065Length: 360 bp (1146 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E694065 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTAAACACCAAAGGAAAATATTCTCATACCTTTGAATAATTAACAAACATTACATGATGGCTGTTATTTCCTGAAA
ATAATTTTTCTTTACAATAAGCTCCAAAAAGCAGCAAGAATATTACTACTACCACATCTTGCCACTAATTATTACAAGGTGATAACTATATATTA
CTATATTCATTCACCTTTGAATCTAAGAACAACACTTCCGGCCACCACCACCACTTCCACCGCGGCCACCGCCACCACCACGGTCCACCACCGCC
GGAGTATCTACCACCACCACGGACTCCGCCACTACCACCGCCAGGGAATCCCCTCAAGCCGAATTCGGCACAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E694065] SGN-U593032 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T493425 [Download] [View] Facility Assigned ID: LH_Ea02P07.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0232 Quality Trim Threshold: 14.5