EST details — SGN-E694468
| Search information |
| Request: 694468 | Match: SGN-E694468 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C467634 | Clone name: LH_Ea04A02 |
| ||
| Library Name: LH_Ea | Organism: Solanum habrochaites (formerly Lycopersicon hirsutum) |
Tissue: Glandular Trichomes
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C467634 [LH_Ea04A02] | Trace: SGN-T497247 | EST: SGN-E690628 | Direction: 5' | Facility: AGI |
| Sequence |
| Sequence Id: SGN-E694468 | Length: 193 bp (1066 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E694468 [] (trimmed)
TTTTTTTTTTTTTTTTTTAAGAAAAAACTTCATTACATAAAGCAACTTTTAAGACACAACAAGTTCATGATTGAACCTTAGTTTTGCCTTTAGAG
GGGGAAAAAAAGCAATATCTAGCTGTTTTTACCTTTGCTTTGACATAGGATTTAACTAGTAAAGATCACTCTCCCCTCGTGCCGAATTCGGCACG
AGG
GGGGAAAAAAAGCAATATCTAGCTGTTTTTACCTTTGCTTTGACATAGGATTTAACTAGTAAAGATCACTCTCCCCTCGTGCCGAATTCGGCACG
AGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E694468] | SGN-U589326 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T493028 [Download] [View] | Facility Assigned ID: LH_Ea04A02.r |
| Submitter: Eyal Fridman | Sequencing Facility: AGI |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.915 | Expected Error Rate: 0.0185 | Quality Trim Threshold: 14.5 |
Working
