EST details — SGN-E694481
| Search information |
| Request: 694481 | Match: SGN-E694481 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C467647 | Clone name: LH_Ea04A15 |
| ||
| Library Name: LH_Ea | Organism: Solanum habrochaites (formerly Lycopersicon hirsutum) |
Tissue: Glandular Trichomes
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C467647 [LH_Ea04A15] | Trace: SGN-T497234 | EST: SGN-E690641 | Direction: 5' | Facility: AGI |
| Sequence |
| Sequence Id: SGN-E694481 | Length: 201 bp (1077 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E694481 [] (trimmed)
TTTTTTTTTTTTTTTTTTAAAGATTAATATCTGATTGATCTACTTCATAAAGAATCACAATACAAAATTAGTTATAAGAAAGAGACCTTTACTGC
GAAATCAGTTCACTAAGAAGAGATCCATTGTCTCGATTGGAAAGGTAAAACCTAAACCCTCGTTCCTTGTACATCTATACTTCACCTTCTCGAGG
AATTTATTTTT
GAAATCAGTTCACTAAGAAGAGATCCATTGTCTCGATTGGAAAGGTAAAACCTAAACCCTCGTTCCTTGTACATCTATACTTCACCTTCTCGAGG
AATTTATTTTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E694481] | SGN-U566166 | Tomato 200607 | Build 2 | 2 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T493015 [Download] [View] | Facility Assigned ID: LH_Ea04A15.r |
| Submitter: Eyal Fridman | Sequencing Facility: AGI |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.907 | Expected Error Rate: 0.0338 | Quality Trim Threshold: 14.5 |
Working
