EST details — SGN-E694681

Search information 
Request: 694681Match: SGN-E694681
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C467847Clone name: LH_Ea04I23
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C467847 [LH_Ea04I23] Trace: SGN-T496545 EST: SGN-E690841 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E694681Length: 315 bp (1087 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E694681 [] (trimmed) TTTTTTTTTTTTTATAAAATTCTTTTCATTTTATAAACTAAATCAATAAAAGACGATACAGNTATTATGAAATAGAAGATTAATCCTTGAAATAC
GTTACTATCGTCTATCTATATTACTGGCTATTACAATTTTATTTTATATTTTTATCTTTATTTTTACTGCATATTACATTGAAATTCAAAATACT
TAGGTTACCAAGTTTGGTTATATTATTACAATATCCCTTTTACTAACGAGATATGCTGGAATGTAAGAAAAAATGTATACATAGTTAGACTCCAT
CGAGCTAAAGAAAATAGTAACAGACAAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E694681] SGN-U588986 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T492767 [Download] [View] Facility Assigned ID: LH_Ea04I23.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.887 Expected Error Rate: 0.0200 Quality Trim Threshold: 14.5