EST details — SGN-E694962

Search information 
Request: 694962Match: SGN-E694962
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468128Clone name: LH_Ea05E16
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468128 [LH_Ea05E16] Trace: SGN-T496753 EST: SGN-E691122 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E694962Length: 256 bp (1133 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E694962 [] (trimmed) TTTTTTTTTTTTTTTTTCATAATAAAATATTGATAATAAAATTACCCCTTCAGTGGCTTTTATTCAATACATTTTTACTAATATTATCCCAAGCT
CTAAAGTAGAAAGAGCATTGCTAATAATATTACATAATTGCCATTACAAAAGTTTTAATATAATATACTACGTACTCCACACATAATTAATTAAT
TGTGTGGCTTAGCTTGAGTAACTTTGTCCATTGCCTCACCTTTATAGGAGCAACACCTATAGCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E694962] SGN-U590942 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T492460 [Download] [View] Facility Assigned ID: LH_Ea05E16.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.881 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5