EST details — SGN-E695135

Search information 
Request: 695135Match: SGN-E695135
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468301Clone name: LH_Ea05L21
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468301 [LH_Ea05L21] Trace: SGN-T496133 EST: SGN-E691295 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E695135Length: 466 bp (1084 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E695135 [] (trimmed) TTTTTTTTTTTTTTTATGAAGCCTATACCAGAACCAAATACCCTTTGTGATTTTCCAGAACTAAATAATATAATTTCTTACCCTTTCAAATTTTG
ATATGGACTATTTACCTCTCATCCTCCTATACTAAAGGTGATGGAAAAAGTTATTGATTTTATCCCCCACCCATCCTAAAATTAAAAATTATCCC
TTAATGCTTGTACCAAATGAGCCCTTAATAACAAGTTTCAAAATTTCATACAAAATATACAATTAAATAACTACACCAATATAAGCATCCACTTC
CCTTGGAAATTCAAATAAAGATGAAACACACATTGAAGGCATTTATGCAACAGGAACTTTGCCACAAATATCAAAAATATCTTCCATAGGAGCAT
GGCCACCGGTCCCTTCATACTTCCATGCATACAACAACTGCTTCCCTTTAAAAAAAAACATCCCTCCTGCCCAATTCCGCACAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E695135] SGN-U593961 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T492234 [Download] [View] Facility Assigned ID: LH_Ea05L21.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.912 Expected Error Rate: 0.0249 Quality Trim Threshold: 14.5