Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E695293

Search information 
Request: 695293Match: SGN-E695293
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468459Clone name: LH_Ea06C11
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468459 [LH_Ea06C11] Trace: SGN-T496422 EST: SGN-E691453 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E695293Length: 261 bp (1055 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E695293 [] (trimmed) GTTCATTAGAACTCATCACATCTTTATAGCAGGCTATCTTTAAGAATTCAACTATACTACCTTCAATTTGTTGGTCATTACAAGGGAGACTAGTT
AATCTGAAAGCAATTTGACAGTGCCTGTTGTACCAAAACGTCTACCTGGAATGACTCTTGATGGTGATAAAATTTCTGCAAAAGAAAAGTTGTAC
GAATCTGTTCCTAGCCGACTCTGCAACCACCCCTTGCCTCCGGAGAACCTCGTGCCGAATTCGGCACGAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E695293] SGN-U587853 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T492152 [Download] [View] Facility Assigned ID: LH_Ea06C11.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0135 Quality Trim Threshold: 14.5