EST details — SGN-E696116

Search information 
Request: 696116Match: SGN-E696116
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469282Clone name: LH_Ea08E18
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C469282 [LH_Ea08E18] Trace: SGN-T495214 EST: SGN-E692276 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E696116Length: 379 bp (1099 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E696116 [] (trimmed) TTTTTTTTTTTTTTTTTTGAAATCTTAAATCATTTGTTTCCCTCCCTATAGATTACCACTTACTGCCTTGTTGTAAATAGCATCCCTCCATTCCA
TTATTTTTGCAAAACAAAGAAAGACAATTTCAACCATAAGCCTTTAGTTAAATCTCACCCTCTTAAGGCTAGAGCTCAGTTGTTTTTTGGAATGG
CAATTACAGAAGTAGCAAATTAAATTTTATGGTGCAGGTTTCTGAATGAGGAAGGCCATGCACTGTGCCTGCTTAACATTATCAAACGCCAAGCA
ACGAATAAAAGCATTTGGGTAAGCTTTCTTGCATTCTTGGATTTCATTGAGAACCTGGGAAGAGTCATTGCAGCCAAACATGGGCAACTTCCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E696116] SGN-U572962 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T491331 [Download] [View] Facility Assigned ID: LH_Ea08E18.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5