EST details — SGN-E696138

Search information 
Request: 696138Match: SGN-E696138
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469304Clone name: LH_Ea08F16
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C469304 [LH_Ea08F16] Trace: SGN-T495185 EST: SGN-E692298 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E696138Length: 1730 bp (untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E696138 [] (untrimmed)
NNNTTTAAAAAGGAAGAGGNNNNGGAAGGGGGGAGAGCCGGNCCTTATTCNANTCTTTTNNNNTTNNNCNTACCAAAAACAAAACGGGTGGTGGN
GTAAANNNNNNGNAGGGGGACCAATAAGAAGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNGGGGNNACCCTCATAAAAAGAGGG
GAGNGNGGNGNGNGTGTTGGAAGANAAGGGGGGGAGAGAGGGGGAAAAGAAAGAAAAGAGGAAGAGAGGGAGGGGAGGAGGAGGAGAGGGAAGAA
AGCGCCAGAAGAGAGAAAGAGAGGAGAGGGGGGAGAGGAANAGAGGAGGGGGAGGGGAGGGGAGGGGGGAAAGGGAAAGGGAGAAGANAAGAGGG
AGAAGAAAGAGAGGAGAGGAGAANAGGAGAGGAAAGGAGAGGGGAGGAGGAGGGGGAGGGAAGGAAGGAGAAGGAGGAGGAAGAAGNAGAAGAGA
GAGAGAGAGGAAGGAAGAGAGAGAGGANAGAGAGAGGGAAGAGAAGGAGAGGAGGNGAGNGGAGAGGAGAAAGAAAAAGAGGAGGAGGGAAGNAN
GNGAAGAGAGAAGGAGAAGGAGAGAGAGAGAAGAGGGGAGAGGAGAGGAAGGAGAGAAGAGAGAGAGAGGAGGAAGGGGGAGAAGAAGGAGAGAG
AGAAGAAAGGAAGAGGGGGAGGGGAAGGGGAGGAGAGAGAAAAGGGGGAGGGAGGGGGAAAGAGGGGAAGGGAGGGAGAAGGGAAGGAGAGGGAG
GAAGGGAGGGAGAGGAAGGAAGGNGAGGAAGAGGGGGAGGAGAAAGAGGGGAGGAGAGGANGGAGGAGAAAAGGGAGAGGGGAAGAGGANGGAAG
AGNGGAGAGGGAGAAAAAGAAGAGGGGAAAGGGGAGGGGGGGAGGGAGGAAGGGGAAAGANGAGGAGGAGGAAGGAAAGAGGGGGGAAAAGGGAA
GAGAGAAAGGAGGGGAGAGGAAGGAGAAGGAGAGGGAGGAGGGGAGAGGAGGGGAGAGAAAGGAAAGGGGAAAGAGGGGGAGAGGAGAGAAAGAG
GAGGGAGAGGGGGAGAAGGGAGGGAGAAGGAGGGGAAGAAAAGGAAAGGGGAGGGGGGGAGGAGAGAGGGAGGGGAGGGGAAGAAGAGGGAGGNG
GAGGGAGAAGGGGAGGAGGGGAAAGAGAAAAGGGAGGGAAGAGGAGGGGGGAAGAGAGGGGGAGGGGAGGAGGAAGGGGGGAAAGGAGAAGGGGA
GGGGGGAGGAGAGGGAGAGAAGGAGGGGAGAAGAAGGAAGAGGGAGGAGAGAGGGAGAGGGAGAGGAGGGGGGGAGAGAGAGAGGAAAAGGGGAG
GGGAGAAGGAGGAGGAGGAGGGAAGAAGAGAGAAGAGAGGAAGGGGAAGGGGAGGGGAGAGGGAGAGGGAGAGAGGGAGGGGAGGGAAAAAGGGG
GGGGGAGAAGAGAGGAGGGGGAGGGGAGGGGGAGGAGAGGGGGAAAAGAAGAGAGGGGGAGGAGAAGAGAGGAGGGGGGAAGAAGGGGAGGGNGG
GAGGGAGAGAGGGAGAGAGGAGAGGGGAGGGAGAGGAAAGAGAGGGAGGAGGGGAGAAGAGGAGGAGAGAAGAGAGAGAGGAGGAGAGGGAGGAA
GAGAGAGAGGGGGGAAGAGGGGAGGGGAGAAGAGGGAGGGGGAAAGAAAGAAGGGGAAAGAGAGAGGAGGAGGAGGAAGAAGAGAAAGGAGAGGG
AGAGGGAACAAGAGAGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T491309 [Download] [View] Facility Assigned ID: LH_Ea08F16.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Problems: Too short after trimming low-quality bases
Low complexity
Sequence Entropy: 0.000 Expected Error Rate: 0.0079 Quality Trim Threshold: 20.5