EST details — SGN-E696726

Search information 
Request: 696726Match: SGN-E696726
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469892Clone name: LH_Ea09O04
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E696726Length: 215 bp (1057 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E696726 [] (trimmed) TTTTTTTTTATTTTTTTTTTTTTTTAAAAAGCAGGAATGTATAGCCCTTTATATAAAATCTTAAAAGCTAGTACTTCCAAAAGTTACAACATAAA
TCAAAATTATCCCATTACATCATTTAACTGAAGGGAGATGCAAATCAAAAGGCTCTAATGCCATATGTCTCTACCAGTACCAAATGTAGAGGTCC
TCGTAAAAACTCATATTCAAGATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E696726] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T490695 [Download] [View] Facility Assigned ID: LH_Ea09O04.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.884 Expected Error Rate: 0.0172 Quality Trim Threshold: 14.5