EST details — SGN-E696726
| Search information |
| Request: 696726 | Match: SGN-E696726 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C469892 | Clone name: LH_Ea09O04 |
| ||
| Library Name: LH_Ea | Organism: Solanum habrochaites (formerly Lycopersicon hirsutum) |
Tissue: Glandular Trichomes
Development Stage:
Microarray: This clone is not found on any microarray
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E696726 | Length: 215 bp (1057 bp untrimmed) |
| Status: Current Version | Direction: 3' |
>SGN-E696726 [] (trimmed)
TTTTTTTTTATTTTTTTTTTTTTTTAAAAAGCAGGAATGTATAGCCCTTTATATAAAATCTTAAAAGCTAGTACTTCCAAAAGTTACAACATAAA
TCAAAATTATCCCATTACATCATTTAACTGAAGGGAGATGCAAATCAAAAGGCTCTAATGCCATATGTCTCTACCAGTACCAAATGTAGAGGTCC
TCGTAAAAACTCATATTCAAGATCC
TCAAAATTATCCCATTACATCATTTAACTGAAGGGAGATGCAAATCAAAAGGCTCTAATGCCATATGTCTCTACCAGTACCAAATGTAGAGGTCC
TCGTAAAAACTCATATTCAAGATCC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E696726] | SGN-U579080 | Tomato 200607 | Build 2 | 130 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T490695 [Download] [View] | Facility Assigned ID: LH_Ea09O04.r |
| Submitter: Eyal Fridman | Sequencing Facility: AGI |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.884 | Expected Error Rate: 0.0172 | Quality Trim Threshold: 14.5 |
Working
