EST details — SGN-E71547

Search information 
Request: 71547Match: SGN-E71547
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67001Clone name: cLEN-17-B24
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C181051 is on microarray TOM1: SGN-S1-1-8.4.17.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67001 [cLEN-17-B24] Trace: SGN-T91015 EST: SGN-E276594 Direction: 5' Facility: TIGR
Clone: SGN-C181051 [TUS-35-P9] Trace: SGN-T196427 EST: SGN-E395101 Direction: 5' Facility: INRA
Clone: SGN-C181051 [TUS-35-P9] Trace: SGN-T197736 EST: SGN-E396410 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E71547Length: 620 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E71547 [] (called/trimmed by facility)
TTTCTTAAGTGTTTGGTTGTGTCTGTTTTGTTCATGTTCCTCATGTTAGACGTGACAAACTTGACAAGAAGGCAATCGGCAATCATAGGCATCCA
TGTGGCTTACAGTGAAGTTTCTAAAGCCTACAAGGTCTATCATCCTCAGACAAAGAAGATGACAATTACAAGAGATGTTCATTTTAGTGAGAATG
AATAGTGGGACTGGAAGAACTCTCATAAATCAGGAAGTCGCTCTCTAGAAGCAAACATCAGTCCTCCTGAAGAGCAAAAAACAGAACACTGGCAG
CAAGAACTAGAAGATGATCATCCAGTCAAGGGGAGGAGGTTGTTGTCAGATATCTATCAGAGGTGTAATGTCGCCATCTATGAACCTGCTGGTCC
CGTAGAAGCTTTGCAAGACCCAAAATGGAAGAAAGCAATGGAGGAGGAGATCTCCATGATTGAGAAAAATAAAACTTGGGTGCTGGTAAACAAAC
CTGAAGATAGAAAAGTCATTGGTGTGAGATGGGTCTTCAGAACAAAGTTAAATGCAGATAGTTCCATCAACAAATACAAAGCGAGGCTTGTAGTT
AAAGGGTATGCACAAATTTATGGTATTGATTACTCTGACACTCCTGTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T91015 [Download] [View] Facility Assigned ID: TRRCP12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence