EST details — SGN-E717049

Search information 
Request: 717049Match: SGN-E717049
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C490215Clone name: FB18DB07
cartOrder Clone
Library Name: FBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E717049Length: 439 bp (1044 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E717049 [] (trimmed) GTCAAAACTCATCCCATGAACCTGTTGAATGAGAGGACACTCAAGGGCACCTTCTTTGGTAACTACAAGCCCAAAACTGATCTCCCATCTGTGGT
GGCCAAGTACATGAATAAGGAACTAGAGCTGGAGAAGTTCATCACCCATCAAGTACCATTTTCAGAGATCAACAAAGCATTTGACATTATGCTGA
AAGGGGAAGGCCTCCGTTGCATGATCACTATGGGACGTTGAAATATGCTAAATAGGGAAAATAGGACAGTATATTACCTAGTAATATAGAGCTTG
AATGTAATAAAACAAACGGTATTTTAATGGGTAAAATAATGTTAAAAGTAGAGTTTGGAGGCAAAGTATATGTTTTCTAAAAGGCCTCCTGAGTT
TGCTCAACATATTGTGTAATAATATTTGCATATTTTGAAAGACTTTTTGAGTTTTGGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E717049] SGN-U598052 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T512748 [Download] [View] Facility Assigned ID: FB18DB07
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5