Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E71728

Search information 
Request: 71728Match: SGN-E71728
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59990Clone name: cLEL-6-P13
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59990 [cLEL-6-P13] Trace: SGN-T17551 EST: SGN-E234773 Direction: 3' Facility: Cereon
Clone: SGN-C59990 [cLEL-6-P13] Trace: SGN-T17839 EST: SGN-E235061 Direction: 3' Facility: Cereon
Clone: SGN-C59990 [cLEL-6-P13] Trace: SGN-T22243 EST: SGN-E280812 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E71728Length: 255 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 3'
>SGN-E71728 [] (called/trimmed by facility)
CGAATAAGTATACGATGGACNTGTCATGGACTNGCGCGTTTGCATTTCGACACTAGCGGATCCAAAGTAGGAATCCACCATTTTCTCTTCTTAGT
CTTTTTTTTTTTAATTATTGTGAAAGGAGAGTTTAAAATTTGGTGTAAAAACGGCTGGAAATGGAGTATTTGCAGAAATAATTGATGGAGAAGTG
TACAAATATTATTGTGAAGGAGAATGGAAAAAATCAGCTTCTGGAAAATCTGTTGCTATTATTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T22243 [Download] [View] Facility Assigned ID: tomato060391.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence