EST details — SGN-E72117

Search information 
Request: 72117Match: SGN-E72117
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C140602Clone name: cTOF-12-M7
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C140602 [cTOF-12-M7] Trace: SGN-T155764 EST: SGN-E343807 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E72117Length: 643 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E72117 [] (called/trimmed by facility)
TCATCCTTTCTCTCTCTACCTCAAACTTTCTCTTTCTAGATCTGGGATCCCTAAATTTCTCCTCATTTTCTCTTTACCATTTCTCTATTCTCATT
TTCATTCACCTTATTCCCTTTCCCCTCTTCTACAATTCTCTCTGAACTTTCCCTTTCGTAGAATTAGGGTTAGGGTTTCACCAAGAGAACCAAAG
AAAACACCATTGGCATGTCTCGATTTTCTTCTCTGCTGGGTTTTCAAGCCATTCTGAAGAAACGACATTGAAAGGAATTGGAGAGGTTAAAAGAA
ACGGAAACAAGAAGCTCCAAGATACCACATTTAATCTCTTTTTTTCTTTTTAAATTTTTTCTGGGATCAGGTCTTCTAAAGAAGATCTGAAAAGA
GGAGGGTTATTGTTGGTTTTCTGAATAGCCGGGAAAAATGAGTGCTTCAAGGTTTATCAAATGTGTTACCGTCGGCGATGGTGCCGTTGGAAAGA
CGTGTCTCTTGATTTCTTACACCAGCAATACCTTCCCCACGGATTATGTGCCCACCGTGTTCGACAATTTCAGTGCAAATGTGGGTCGTCAATGG
GAGCACTGTCAACCTAGGGGTTGTGGGGATACCTGCTGGACCAGGAAGATTACAATAGGGTTAAGACCTTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T155764 [Download] [View] Facility Assigned ID: TOFBS76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence