EST details — SGN-C72139

Search information 
Request: 72139Match: SGN-C72139
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72139Clone name: cLER-1-E2
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178503 is on microarray TOM1: SGN-S1-1-4.2.4.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280543Length: 360 bp (977 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E280543 [] (trimmed) CTCATTCTACTTGTATAATGGCTACTTCTACCATGGCTCTTTCTTCCTCTACATTTGCCGGAAAGGCGGTTAAACTCTACCCATCTTATTCTGAA
ATCACCGCACATGGGAGAGTCACCATGAGGAAAACTGCTACCAAGGCCAAGCCAGCCTGCTCTGGTAGCCCATGGAATGGGCCTGACCGAGTTAA
GAACTTGGGACCATTCTCTGGAGAATCCCCACGCTACTTGACCGGGAGAGTTTCCTGGCGATTACTGATGGGACACTGCTGGACTTTCAGGTGAC
CCTGAAACATTCGCTAACAACCGTGAGTTGGAGGTTATTCATTGCTGATGGGCCATGCTAGGTGCTCTTGGATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280543] SGN-U579181 Tomato 200607 Build 2 140 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92097 [Download] [View] Facility Assigned ID: TPRAB25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0301 Quality Trim Threshold: 14.5