EST details — SGN-E734267

Search information 
Request: 734267Match: SGN-E734267
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C507433Clone name: LB12AH06
cartOrder Clone
Library Name: LBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E734267Length: 728 bp (1156 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E734267 [] (trimmed) GGGAATCAGTAAAAAACCAACTGCAGCCACAACCACCTCCTTGTGATATTTGCCAAGATAAAGCAGCCTTCATCTTCTGTGTTGAGGATAGAGCT
CTCTTTTGCAAGGACTGTGACGAAGCAATTCATTCAGCCAGCAGCCTCGCTAAGAACCACCAACGCTTCTTAGCCACTGGAATCCGTGTAGCCTT
GAGCTCAAGCTGTAATAAGGAATCAGTTGTCCTGTATAACATCACCATCTTGGCCTGTCGATGATTTACTAGGATTTCCAGATTATGAGTCGAGT
GACAAGAAGGATCTACTTGAGCTTGGTGAATTTGAGTGGTTAGGGGGCATTGATCTCTTTGGTGAACAAACAGCAGCTGAAGTGCCCGAGCTATC
AGTACCTCAGTCGAGCAATACAAATATTTACAGGACAACCAAATATCAAATGCCTTACAAGAAGTCCAGAATTGAAATCCCAGATGATGATGAGT
ATTTTACTGTCCCCGATCTTGGTTGAACTCCAACTTCAAGAAGTTTCCAATTAAATGTGCATGTGTGCTTGTGTGTAGTACTTAATCAGTGCTCT
CATACTGTCAACAGATATGTTCAGTAAGTAGAAAAAGTATTGTTCTGCTTAAGATACTCCTTATCTTGCTTACTTTCGCAGTGCGCTCATATTGT
CAACAGACATGTTCAGTAAGTAGAGGAAACACTATTCTGCTTAAGATATCCTTTATCTTGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E734267] SGN-U587566 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T533683 [Download] [View] Facility Assigned ID: LB12AH06
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5