EST details — SGN-E736811

Search information 
Request: 736811Match: SGN-E736811
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C509977Clone name: LC07BC04
cartOrder Clone
Library Name: LCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E736811Length: 352 bp (1306 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E736811 [] (trimmed) CTGGAGATGGATTCCCATTGACGAATCCCTTTTGAAGAGGATGGTAGCATTTTGTGGCGCTTTCTCCTCCTTCCCCGGCCTCTCCAACCCTGATC
GGAGATGCCGTTTTTGCTTGAAAATAGTGTTGGTGATGCTGCATCTGACCTATGTCGGTATTCTATTCGGTTTTGACAAAGAGTTGATTCAAAAA
ACTAAACAAGCCCCCTGGTACATGGCAGTTTATTTGCTGCTGCTTGTTGCTACACTGGCTAAATACTTCGTTGTATCTAGCTTCTTCTCCTGGCT
ATGCTCTTGATGCCCTGAGAGCTATCCCTGACACAGATGCATCCCGTAATAGGGAACCAATTACCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E736811] SGN-U596790 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T540315 [Download] [View] Facility Assigned ID: LC07BC04
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0191 Quality Trim Threshold: 14.5