EST details — SGN-E737713
Search information |
Request: 737713 | Match: SGN-E737713 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C510879 | Clone name: LC10DH04 |
| ||
Library Name: LC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Leaf
Development Stage: Mature leaves
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E737713 | Length: 108 bp (1307 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E737713 [] (trimmed)
TCAACATAGTGAACAAATTTGTGAATATAGCATTATTAGCAGTATGAGTTAGAGCAGGTTATAGATTTTATAAAAAATCATGTATCCTATTAAAG
AAGTTTTCAATTT
AAGTTTTCAATTT
Unigenes |
Current Unigene builds | |||||
[SGN-E737713] | SGN-U604417 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T539871 [Download] [View] | Facility Assigned ID: LC10DH04 |
Submitter: None | Sequencing Facility: Kazusa1 |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.847 | Expected Error Rate: 0.0048 | Quality Trim Threshold: 14.5 |