EST details — SGN-E744824
| Search information |
| Request: 744824 | Match: SGN-E744824 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C523718 | Clone name: GI|19323 |
| ||
| Library Name: vSlycmRNA | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Unknown
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E744824 | Length: 174 bp (192 bp untrimmed) |
| Status: Current Version | Direction: Unknown |
>SGN-E744824 [] (trimmed)
AGTATGAGTAGTAAAAAGGGTTTAGATTACTACTAAGAGTAGTACACCCAAAACCAACTAGAAATTATATATATATAGTACATGCAGACTGCTAT
TAAGTCAAATGCAACTCAAGTTTGCTTTGTCTAGTCAGAAACTTATAATAATAATAATAATATTGGTTCTTGATTTGTG
TAAGTCAAATGCAACTCAAGTTTGCTTTGTCTAGTCAGAAACTTATAATAATAATAATAATATTGGTTCTTGATTTGTG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E744824] | SGN-U595243 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T548994 [Download][View] | Facility Assigned ID: |
| Submitter: None | Sequencing Facility: |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |
Working
