EST details — SGN-E76474

Search information 
Request: 76474Match: SGN-E76474
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106444Clone name: cLPP-2-D22
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C106444 [cLPP-2-D22] Trace: SGN-T173733 EST: SGN-E362873 Direction: 5' Facility: TIGR
Clone: SGN-C180178 [TUS-33-K24] Trace: SGN-T186672 EST: SGN-E373707 Direction: 3' Facility: INRA
Clone: SGN-C180178 [TUS-33-K24] Trace: SGN-T186673 EST: SGN-E373708 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E76474Length: 554 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E76474 [] (called/trimmed by facility)
GGTTAAGGCTCTGTATGTTTGTCAGAGATGCCAAGTCATGTTGCCCTCACCTAGTCATTCTTTCTTATGACTTCGAGGCTTATGAGGAGGTTGCT
GATCGCTTTTATAACATATTGCACAAGTACTGCAACAAAGTGCAGGCCGTTAGTTGTGACGAAGCATTTCTAGATGCCACTGATTCCGGAGTAGA
GGACATTCAAATTTTTGTCTCAGTGATCAGAGAGGAGATTCTTGATGCGACAGGCTGTACTGCTAGTGCTGGTATTGCTGGGAATATGCTTATGG
CGCGTCTTGCTACTAGGATTGCAAAACCAGATGGGCAGTGTTACATCCCTGCTGAGAAGGTGGAGGAGCACCTGCGTGAACTTCCAGTAAAAGCA
CTTCCTGGAATCGGTCACGTGTTGGAAGAGAAGTTGAACAGGAGACAAATCACAACTTGTGGGCAGCTGCGTATGATTTCCAAGGAAACTCTCCA
GAAGGACTTTGGTTCTAAAATTGGCAGTATGCTATGGAACTATAGTTGAGGGATAGATGACCGGTTGGTTGGCATGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T173733 [Download] [View] Facility Assigned ID: TPOAH23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence