EST details — SGN-E79850

Search information 
Request: 79850Match: SGN-E79850
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C105870Clone name: cLPP-1-C11
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C105870 [cLPP-1-C11] Trace: SGN-T174727 EST: SGN-E362666 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E79850Length: 626 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E79850 [] (called/trimmed by facility)
TCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGGCAAAAGTTCTCCTATCAAGGTGGAATGACAGAAGCAAAAAAAACTGAGCG
GAGAAAGGTCCTTGCTAAGTGGTTAAAAGAAACTATTTTGAGATTGGGTCCAACTTTTATCAAGATTGGCCAGCAATTCTCAACAAGAGTGGATA
TTCTTGCTCAGGAGTACGTTGATCAGTTGTCTGAGCTTCAGGACCAAGTTCCTCCTTTCCCATCCGAAACTGCTGTATCAATAGTTGTAGAAGAA
CTTGGCGGCTCATTGGATAATATATTTGAAAGATTTGACCGTGAACCAATAGCTGCTGCAAGTCTTGGTCAGGTGCATCGTGCAAGACTGAATGG
GCAGGAAGTAGTTGTCAAAGTACAAAGGCCCGGTCTTAAGGATCTTTTTGATATCGATCTTAAAAACCTGAGGGTGATAGCTGAATATCTGCAGA
AAATAGATCCTAAATCTGATGGTGCGAAAAGAGATTGGGTTGCAATCTATGATGAATGTGCAAATGTCTTGTATCAGGAGATTGATTACACTAAG
GAAGCTGCCAATGCGGAACTGTTTGCAAGTAACTTCAAAAACTTGGATTATGTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T174727 [Download] [View] Facility Assigned ID: TPOAA18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence