Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-C79984

Search information 
Request: 79984Match: SGN-C79984
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C79984Clone name: cLET-10-O11
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLET-10-O11.
Additional sequencing 
Clone: SGN-C190826 [TUS-61-G16] Trace: SGN-T341774 EST: SGN-E540899 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190826 [TUS-61-G16] Trace: SGN-T341776 EST: SGN-E540901 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290802Length: 676 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290802 [] (trimmed) TAACGCCGCGTTTGGATAAACTCAAAAAAAATATGGCTTCTGCTTTACAAATTTCTTCTCAGTACAGTAAAATTGCTCTTTGTTCTTTATTTCCT
GTTTTTCCAAATTTAAGAAAACCAAACAAGGCACTAAATTCAGTTACCTCAAATTCCAATAAAAAGTTTAAAATTAGAGCATTGAAGGAGAAAAC
AACAGAAGAAGTTAAATCTGCTGAGGAAATTACAAAGAAATTTGGTTTAGAAGCTGGCCTATGGAAGATATTTAGCTCAAAAGAGGATAGAGATG
AAGAGAACAAGGATAAGAAATCAAAAGGGGATCAAGCAAAAGAGCTTTTGGCAAAATATGGAGGAGCTTATTTAGCAACTTCAATTACTCTCTCA
TTGATATCATTTGGTCTCTGTTATGCTCTCATCAATTCTGGTGTTGATGTTCAATCCTTGCTACAAAAGGTTGGTATTTCTACTGATGAGACTGG
TGAGAAAGTGGGAACTTTTGCATTGGCTTATGCCGCTCACAAAGCCGCATCACCTATTAGATTTCCCCCTACTGTTGCTTTAACACCAATTGTTG
CTACTTGGATTGGAAAGAAAGTTGATAAAGAGAAGTAAAACTAGGTTGATTTTGGACACAATTTTGCTGCAGATGTAATATATGTGTTAGTAAAT
ACTACAGGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290802] SGN-U564497 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104971 [Download] [View] Facility Assigned ID: TMEBK90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5