EST details — SGN-E81665

Search information 
Request: 81665Match: SGN-E81665
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71785Clone name: cLER-19-C1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71785 [cLER-19-C1] Trace: SGN-T96523 EST: SGN-E284951 Direction: 5' Facility: TIGR
Clone: SGN-C190023 [TUS-59-F5] Trace: SGN-T340395 EST: SGN-E539520 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E81665Length: 385 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E81665 [] (called/trimmed by facility)
TTTGTACAAATCTTCTTCATCTACCTCGCACTCACACCTAGCAGGACTACTGTGAAGCCGGCGGCAAAGGAAACTGAGAAAATGCCTGGGATTAA
AGGGCCTTCCGATTATTCGCGAGAACCCCCTCGCCATCCTTCTCTTAAAATTAATGCCATGGAAAGATAAACATCAAGGGGTACGCATTATCAGG
AGGTGGGCGTGGCATATAAAGGGTAGACGTGTCTATAGATGGTGGTAAAACTTGGGAGGAAGCCACCAGATACCAGAGAACTGGTGTTCCATATA
TTGCTGATGATTCAAGCAGTGACAGATGGGCATGGGTCTTTTTTGAAGCTGAGGCAGATATTCCCCACAGTGCGGAAATACTTGCTAAAGCGGTG
GATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T96523 [Download] [View] Facility Assigned ID: TPRCU13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence